View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7954_low_5 (Length: 274)
Name: NF7954_low_5
Description: NF7954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7954_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 54181538 - 54181295
Alignment:
| Q |
18 |
agaagagccagggctgcagcactgaacattgtccccaccagcacaggagcagccaaggctgtctctctagtgctgccacagctcaagggaaagctcaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
54181538 |
agaagagccagggctgcagcactgaacattgtccccaccagcacaggagcagccaaggctgtctctctagtgctgccacagctcaagggaaagctcaacg |
54181439 |
T |
|
| Q |
118 |
gaatcgcccttcgtgtgccaacacctaatgtttcagttgttgaccttgtggtgaatgttgcgaagaagggtatttcagctgaagatgtcaatgcagcatt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54181438 |
gaatcgcccttcgtgtgccaacacctaatgtttcagttgttgaccttgtggtgaatgttgcgaagaagggtatttcagccgaagatgtcaatgcagcatt |
54181339 |
T |
|
| Q |
218 |
cagaaaggcagctgagggaccactgaaaggtgttttggatgtct |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54181338 |
cagaaaggcagctgagggaccactgaaaggtgttttggatgtct |
54181295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University