View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7955_high_1 (Length: 355)

Name: NF7955_high_1
Description: NF7955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7955_high_1
NF7955_high_1
[»] chr7 (2 HSPs)
chr7 (288-350)||(25107673-25107735)
chr7 (18-79)||(25106424-25106486)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 288 - 350
Target Start/End: Original strand, 25107673 - 25107735
Alignment:
288 tattgagaatctctttcatgaagaatctccaaccccacaggtgatggagcacatgatgatgtc 350  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
25107673 tattgagaatctctttcatgaagaatctccaaccccacaggtgatggagcacatggtgatgtc 25107735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 25106424 - 25106486
Alignment:
18 cttataagttataatccaccaaatnnnnnnncaaaagattatgctaactt-ttttccaagtgc 79  Q
    ||||||||||||||||||||||||       ||||||||||||||||||| | ||||||||||    
25106424 cttataagttataatccaccaaataaaaaaacaaaagattatgctaacttatattccaagtgc 25106486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University