View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7955_low_2 (Length: 355)
Name: NF7955_low_2
Description: NF7955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7955_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 288 - 350
Target Start/End: Original strand, 25107673 - 25107735
Alignment:
| Q |
288 |
tattgagaatctctttcatgaagaatctccaaccccacaggtgatggagcacatgatgatgtc |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25107673 |
tattgagaatctctttcatgaagaatctccaaccccacaggtgatggagcacatggtgatgtc |
25107735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 25106424 - 25106486
Alignment:
| Q |
18 |
cttataagttataatccaccaaatnnnnnnncaaaagattatgctaactt-ttttccaagtgc |
79 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
25106424 |
cttataagttataatccaccaaataaaaaaacaaaagattatgctaacttatattccaagtgc |
25106486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University