View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7956_high_23 (Length: 237)
Name: NF7956_high_23
Description: NF7956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7956_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 53211362 - 53211144
Alignment:
| Q |
5 |
cttgaaggagtggataatgaatttatatgggcttatactcgaggaagagtctgttcagtaaccggtgtgagtttttgaaaactcatattatttaaaagtg |
104 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
53211362 |
cttgaaggaatggataatgaatttatatggacttatactcgaggaagagtctgttcggtaaccggtgtgagtttttgaaagctcgtattacttaaaagtg |
53211263 |
T |
|
| Q |
105 |
taaatattgaacatcaaataaatgagatgactcataaatataatgtctttaacattcaacttataatccaaatatgatcatccaaactctcctcgtaaca |
204 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53211262 |
caaatattgaacatcaaataaatgaaatgactcataaatataatgtctttaacactcaacttataatccaattatgatcatccaaactctcctcgtaaca |
53211163 |
T |
|
| Q |
205 |
taaattattatgattcatt |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
53211162 |
taaattattatgattcatt |
53211144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University