View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7956_high_24 (Length: 231)
Name: NF7956_high_24
Description: NF7956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7956_high_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] scaffold0005 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 35830120 - 35829890
Alignment:
| Q |
1 |
agtctgtccaagattttggtgacaatccatgttttagagtctcatgcagaatgtttatccacaactcaccacctgagacatcgacaaaaggaaattcacc |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35830120 |
agtctgtccaagattttggtgccaatccatgttttagagtctcatgcagaatgtttatccacaactcaccacctgagacatcgacaaaaggaaattcacc |
35830021 |
T |
|
| Q |
101 |
ggtctgaattttcatttcaggactctgaagtgactccattttgatgactagtccttgatgtgcttgtgcttgaccttgaagggaatgtccatggcctcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35830020 |
ggtctgaattttcatttcaggactctgaagtgactccattttgatgactagtccttgatgtgcttgtgcttgaccttgaagggaatgtccatggcctcta |
35829921 |
T |
|
| Q |
201 |
gcagctaccttcaactctgaatcagatcctt |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
35829920 |
gcagctaccttcaactctgaatcagaccctt |
35829890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 82
Target Start/End: Complemental strand, 54433 - 54354
Alignment:
| Q |
3 |
tctgtccaagattttggtgacaatccatgttttagagtctcatgcagaatgtttatccacaactcaccacctgagacatc |
82 |
Q |
| |
|
|||||||| ||| |||||| ||| |||| ||| | ||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
54433 |
tctgtccatgatcttggtgccaacccatatttcaaagtctcatgcaagatgtttatccacaattcaccaccagagacatc |
54354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 3 - 82
Target Start/End: Original strand, 14785297 - 14785376
Alignment:
| Q |
3 |
tctgtccaagattttggtgacaatccatgttttagagtctcatgcagaatgtttatccacaactcaccacctgagacatc |
82 |
Q |
| |
|
|||||||| ||| |||||| ||| |||| ||| | ||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
14785297 |
tctgtccatgatcttggtgccaacccatatttcaaagtctcatgcaagatgtttatccacaattcaccaccagagacatc |
14785376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 97
Target Start/End: Original strand, 13415434 - 13415528
Alignment:
| Q |
3 |
tctgtccaagattttggtgacaatccatgttttagagtctcatgcagaatgtttatccacaactcaccacctgagacatcgacaaaaggaaattc |
97 |
Q |
| |
|
|||||||||||| |||||| ||| |||| || | |||||||||| ||| |||||||| || ||||| ||||| ||||| ||| |||||||||| |
|
|
| T |
13415434 |
tctgtccaagatcttggtgccaaaccatacttcaatgtctcatgcaaaatctttatccataattcacctcctgacacatccacataaggaaattc |
13415528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University