View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7956_low_21 (Length: 259)
Name: NF7956_low_21
Description: NF7956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7956_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 39095442 - 39095674
Alignment:
| Q |
19 |
gatgatgcatgaagtacgcgccaaagttcgtaacaagttttgttcctaaatagaagtgttgtcaacattgttattattagggttctcaga--tgatagtg |
116 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39095442 |
gatgatgcatgaagtacacaccaaagttcgtaacaagttttgttcctatatagaagtgttgtcaacattgttattattagggttctcagagatgatagtg |
39095541 |
T |
 |
| Q |
117 |
agcaggagacaatcaatgttgttctctctttcaaattttccttcgagcatattatggactaatatgtgtcttcatatttttgtgaaaatgtggctttatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
39095542 |
agcaggagacaatcaatgttgttctctctttcaaattttccttcgagcatattatggactaatatgtgccttcatatttttgtgaaaatgtggctttgtc |
39095641 |
T |
 |
| Q |
217 |
ctctatttcacactgttaatgtcgcatattcat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39095642 |
ctctatttcacactgttaatgtcgcatattcat |
39095674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University