View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7956_low_27 (Length: 215)
Name: NF7956_low_27
Description: NF7956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7956_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 44799246 - 44799453
Alignment:
| Q |
1 |
aaaatttcaaaacacaaaggattgatacagggacgttaaaataagtaaatacttcaataatacaa-aactcttttcttatataactgata-----ttaca |
94 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
44799246 |
aaaatttcaaaacacataggattgatatagggacgttaaaataagtaaatacttcaataatacaataactcttttcttatataactgatagtgtattaca |
44799345 |
T |
 |
| Q |
95 |
agtgagtacattaaaaacagtattaaccatatattttaactcgagggacgagttggatgtgcataatcaaggactactttatcattttgatacattcatt |
194 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44799346 |
agtgagtacattgaaaacagtattaaccatatattttaactcgagggacgagttggatgtgcataatcaaggactactttatcattttgatacattcatt |
44799445 |
T |
 |
| Q |
195 |
tactattg |
202 |
Q |
| |
|
|||||||| |
|
|
| T |
44799446 |
tactattg |
44799453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University