View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7956_low_6 (Length: 507)
Name: NF7956_low_6
Description: NF7956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7956_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 327
Target Start/End: Complemental strand, 29248673 - 29248366
Alignment:
| Q |
19 |
cctatgtcataagagagaccagattcttctccttgattcatccaaacaactgcataggtatctttaaatctatcatggtaatagccataggcgaacgcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
29248673 |
cctatgtcataagagagaccagattcttctccttgattcatcaaaacaactgcataggtatcttcaaatctatcatggtaataaccataggcgaacgcct |
29248574 |
T |
 |
| Q |
119 |
cacccttgaacccaattgcttttgcctcatcatgggttatttcaaccattttttctgcaacctacaacaacaacaacaaaaataagatttnnnnnnnnnn |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29248573 |
cacccttgaacccaattgcttttgcctcatcatgggttatttcaaccattttttctgcaacctacaacaacaacaacaaaaataagatat-aaaaaaata |
29248475 |
T |
 |
| Q |
219 |
ntgaaaatggtaatgtccatagatacttagtacttacagaatactttctcttgaatcctagctcatgaataagttcaatatacttcctcttcccctcctc |
318 |
Q |
| |
|
||||||| || ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29248474 |
atgaaaatagtgatgtccatatatacttagtacttacagaatattttctcttgaatcctagctcatgaataagttcaatatacttcctcttcccctcctc |
29248375 |
T |
 |
| Q |
319 |
cttcacctc |
327 |
Q |
| |
|
|| |||||| |
|
|
| T |
29248374 |
ctccacctc |
29248366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 403 - 444
Target Start/End: Complemental strand, 29248353 - 29248310
Alignment:
| Q |
403 |
atcattaaactc--gggaatgggggaggttcacatgcacttcct |
444 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29248353 |
atcattaaactcaggggaatgggggaggttcacatgcacttcct |
29248310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University