View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7957_high_1 (Length: 253)
Name: NF7957_high_1
Description: NF7957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7957_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 42330329 - 42330111
Alignment:
| Q |
19 |
ctgacaacttgcaaaggatggaccccgcacaaagctttatctgacctgtttgagtgagtgagtgagctgggaagaaaaatggcttttattagtcgacaca |
118 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
42330329 |
ctgacaacttgcaaaggatggagcccacacaaagctttatctgacctgtttgagtgag--------ctgagaagaaaaatggcttttattggtcgacaca |
42330238 |
T |
 |
| Q |
119 |
ttcatttgatcaggtttatagccaatcaagaactgattccaagtgacccgtcatgggcatcaattcagtgttaattggcacagtaacaattaaatgtaac |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42330237 |
ttcatttgatcaggtttacagccaatcaagaactgattccaagtgacccgtcatgggcatcaattcagtgttaattggcacagtaacaattaaatgtaac |
42330138 |
T |
 |
| Q |
219 |
acatgcggtatataatttgatattctt |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42330137 |
acatgcggtatataatttgatattctt |
42330111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University