View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7957_high_3 (Length: 250)
Name: NF7957_high_3
Description: NF7957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7957_high_3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 59 - 250
Target Start/End: Complemental strand, 26406889 - 26406697
Alignment:
| Q |
59 |
ataatcccatatattctttattcacacaca--tatttatatgtgcatttaccgacgaatatcattcaaaagaaagatttcaagctgggatgagaagaaac |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26406889 |
ataatcccatatattctttattcacacacacatatttatatgtgcatttactgacgaatatcattcaaaagaaagatttcaagctgggatgagaagaaac |
26406790 |
T |
 |
| Q |
157 |
atcttttgcactgaaatgctataggaatgaaaagcagagctggaaaaagaaaatgcagattcgacatttacaaatataaagggatcgtaaactt |
250 |
Q |
| |
|
||||||||||||||||||||| |||||||| || | |||||| |||| |||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
26406789 |
atcttttgcactgaaatgctacaggaatgacaacccgagctgaaaaatgaaaatgcagattcgaca-ttacaaatataaagggatcctaaactt |
26406697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University