View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7957_low_4 (Length: 224)
Name: NF7957_low_4
Description: NF7957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7957_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 35 - 166
Target Start/End: Complemental strand, 29461635 - 29461503
Alignment:
| Q |
35 |
aatatcaatcactgaatgaaggctaccctt-agaaagcctaacaaaatcattttgaagattagatttagatcattgtttgtatatgtactacatattcat |
133 |
Q |
| |
|
||||| |||||||||||||||||||||||| || |||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29461635 |
aatattaatcactgaatgaaggctaccctttagctagccaaacaaaattattttgaagattagatttagatcattgtttgtatatgtaatacatattcat |
29461536 |
T |
|
| Q |
134 |
cttttccacatctcttattacatatcctcaact |
166 |
Q |
| |
|
||||||||||||||||| || |||||||||||| |
|
|
| T |
29461535 |
cttttccacatctcttaataaatatcctcaact |
29461503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 35 - 166
Target Start/End: Complemental strand, 29471270 - 29471138
Alignment:
| Q |
35 |
aatatcaatcactgaatgaaggctaccctt-agaaagcctaacaaaatcattttgaagattagatttagatcattgtttgtatatgtactacatattcat |
133 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
29471270 |
aatattaatcactgaatgaaggctaccctttagatagcctaacaaaatcattttgaagactagatttagatcattgtttgtatatgtcctacatatttat |
29471171 |
T |
|
| Q |
134 |
cttttccacatctcttattacatatcctcaact |
166 |
Q |
| |
|
||||| |||||||||| || ||||||||||||| |
|
|
| T |
29471170 |
ctttttcacatctcttgttgcatatcctcaact |
29471138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University