View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7959_high_9 (Length: 268)
Name: NF7959_high_9
Description: NF7959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7959_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 253
Target Start/End: Original strand, 54979858 - 54980096
Alignment:
| Q |
11 |
taattcttgaaacttgtagtatgataaacatgagacttaccattgctttgagctctgcgccctttaggcttttcactaaatgaaaggatcctctatttat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54979858 |
taattcttgaaacttgtagtatgataaacatgagacttaccattgctttgagctctgcgccctttaggcttttcactaaatgaaaggatcctctatttat |
54979957 |
T |
 |
| Q |
111 |
tgtcaaccttcattaggccaaaatctgaggtgcagctatagtggttgaataaaacattagttatgatgccaatttgataaggctaaatattagacatgtt |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54979958 |
tgtcaatcttcattaggccaaaatctgaggtgcagctatagtggttgcataaaacattagttatgatgtcaatttgataaggctaaatattagacatgtt |
54980057 |
T |
 |
| Q |
211 |
ttgaatgccaaatgaggaggccggctcatcagtatgtaaattt |
253 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54980058 |
ttgaatgccaaatgagga----ggctcatcagtatgtaaattt |
54980096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 28 - 150
Target Start/End: Original strand, 54971476 - 54971597
Alignment:
| Q |
28 |
agtatgataaacatgagacttaccattgctttgagctctgcgccctttaggcttttcactaaatgaaaggatcctctatttattgtcaaccttcattagg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
54971476 |
agtatgataaacatgagacttaccattgctttgagctctgctcc-tttaggcttttcactaaatgaaaggatccttcctttatcatcaatcttcattaga |
54971574 |
T |
 |
| Q |
128 |
ccaaaatctgaggtgcagctata |
150 |
Q |
| |
|
||||||||||||| || |||||| |
|
|
| T |
54971575 |
ccaaaatctgaggcgcggctata |
54971597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University