View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7960_high_33 (Length: 286)
Name: NF7960_high_33
Description: NF7960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7960_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 10 - 271
Target Start/End: Complemental strand, 37936406 - 37936145
Alignment:
| Q |
10 |
ggtgtttcagaaaccgttgatcagatgttgggaaatgccttcagttggaaccgtactgactatgcgaggattcaggtactaagccaaatttgtgaatttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936406 |
ggtgtttcagaaaccgttgatcagatgttgggaaatgccttcagttggaaccgtactgactatgcgaggattcaggtactaagccaaatttgtgaatttt |
37936307 |
T |
 |
| Q |
110 |
ctcgataatttctgatagaagacatgtctagtccaacattgtaaagcaccgacacatatgattatactcgattgtcattcttaattattagcttcaatca |
209 |
Q |
| |
|
||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37936306 |
ctcgataatttatgatagaagacgtgtctggtccaacattgtaaagcaccgacacatatgattatactcgattgtcattcttaattattagcttcaatta |
37936207 |
T |
 |
| Q |
210 |
tctaatgttcatgtttgtatcttttgcttcttactatttctgtcttatgcactgtttggttt |
271 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37936206 |
tctaatgtccgtgtttgtatcttttgcttcttactatttctgtcttatgcactgtttggttt |
37936145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University