View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7960_high_42 (Length: 236)
Name: NF7960_high_42
Description: NF7960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7960_high_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 5414780 - 5414578
Alignment:
| Q |
18 |
atgaatgtggctctgctattgacaaacaattgatgagaaaaactatttgagaagtagttatagtttgagtagatatatagtttcttaaacattaatttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5414780 |
atgaatgtggctctgctattgacaaacaattgatgagaaaaactatttgagaagtagttatagtttgagtagatatatagtttcttaaacattaatttga |
5414681 |
T |
|
| Q |
118 |
tatttcaacacaattcctttgttggaataaaatatatag----ttaaccccccttatatcatgaatttgataatattatgacaacaactcgaagtcatgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5414680 |
tatttcaacacaattcctttgttggaataaaatatatagttaattaaccccccttatatcatgaatttgacaatattatgacaacaactcgaagtcatgg |
5414581 |
T |
|
| Q |
214 |
ttc |
216 |
Q |
| |
|
||| |
|
|
| T |
5414580 |
ttc |
5414578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University