View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7960_low_29 (Length: 327)
Name: NF7960_low_29
Description: NF7960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7960_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 164 - 310
Target Start/End: Complemental strand, 28535911 - 28535761
Alignment:
| Q |
164 |
gagtaccttcctacctttatgtttggctcttcaactgctgctagttgattaccttgaattccctgccattaatttcaagttaacatttatttaataaaac |
263 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28535911 |
gagtaccttcctacctttatgtttggttcttcaactgctgctagttgattaccttgaattccctgccattaatttcaagttaacatttatttaataaaac |
28535812 |
T |
|
| Q |
264 |
taatcatatagtatat----acatgtctatctatatttgtatgtgattctt |
310 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28535811 |
taatcatatagtatatacatacatgtctatctatatttgtatgtgattctt |
28535761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 28536070 - 28535980
Alignment:
| Q |
1 |
gaatgatattgtgaatttcaaattcttgtttattaattcaaaattaattnnnnnnnnnnnnctagcatgtgagaaaatatataagaccttgatgg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28536070 |
gaatgatattgtgaatttcaaattcttgtttattaattcaaaattaatt----aaaaaaaactagcatgtgagaaaatatataagaccttgatgg |
28535980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University