View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7960_low_39 (Length: 272)
Name: NF7960_low_39
Description: NF7960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7960_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 168 - 253
Target Start/End: Original strand, 40592158 - 40592243
Alignment:
| Q |
168 |
tttcattggaaacaacccggatttgtctctaaattgtgtttgttttgtttattattaaattatattatgcaaaaacttatgatata |
253 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
40592158 |
tttcattggaaacaaccaggatttgtttctaaattgtgtttgttttgtttattattaaaacatattgtgcaaaaacttatgatata |
40592243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 131 - 168
Target Start/End: Original strand, 40592104 - 40592141
Alignment:
| Q |
131 |
attttttgaggtaacttaacttcatttacgagttgagt |
168 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
40592104 |
attttttgagataacttaacttcatttacgggttgagt |
40592141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University