View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7960_low_45 (Length: 239)
Name: NF7960_low_45
Description: NF7960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7960_low_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 7 - 132
Target Start/End: Original strand, 32433763 - 32433888
Alignment:
| Q |
7 |
gtaagagaaatcatagtcaagcaatttggaccatccaatctagatagaagagctcacgttccaacttggtatactttgaatccggttttcaaagtcggaa |
106 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32433763 |
gtaagagaattcataatcaagcaatttggaccgtccaatctagatagaagagctcacgttccgacttggtatactttgaatccggttttcaaagtcggaa |
32433862 |
T |
 |
| Q |
107 |
actgaaaagttcaatcttaatatgat |
132 |
Q |
| |
|
| |||||||| ||||||||||||||| |
|
|
| T |
32433863 |
agtgaaaagtccaatcttaatatgat |
32433888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 106
Target Start/End: Original strand, 32433574 - 32433655
Alignment:
| Q |
23 |
tcaagcaatttggaccatccaatctagatagaagagctcacgttccaacttggtatactttgaatccggttttcaaagtcggaa |
106 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |||||||||||||| ||| || || |||||||| | ||||||||||||||| |
|
|
| T |
32433574 |
tcaagcaatttggaccgtccaatgaagataagagagctcacgttccgactagg--tagtttgaatctgattttcaaagtcggaa |
32433655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University