View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7960_low_51 (Length: 227)
Name: NF7960_low_51
Description: NF7960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7960_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 45668214 - 45668017
Alignment:
| Q |
12 |
tagcagagatatctattttctgttctttcgaatgaaactaagactcc-taactagttgacaaaattgaaatcaattatcaatgattatgattaccgatgt |
110 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668214 |
tagcagagagatctattttctgttcttttgaatgaaactaagactccctaactagttgacaaaattgaaatcaattatcaatgattatgattaccgatgt |
45668115 |
T |
|
| Q |
111 |
aggatcaaggtgattagtacaaatctgcggtagattcttctgtgcttcctacaatgatcaaacaaataattctcagcatgccttacaaatgttgcaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45668114 |
aggatcaaggtgattagtacaaatctgcggtagattcttctgtgcttcctacaatgatcaaacaaataattctcagcatgccttacaaatgttgcaac |
45668017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University