View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7960_low_57 (Length: 212)
Name: NF7960_low_57
Description: NF7960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7960_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 36680398 - 36680580
Alignment:
| Q |
15 |
aatatcactagtaaataatttataagagtgagattaaaatattaatagtagatattgaactctggccacctccatatagctctttcggtgttccaattca |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36680398 |
aatatcatcagtaaataatttataagagtgagattaaaatattaatagtagatattgaactctggccacctccatatagctctttcggtgttccaattca |
36680497 |
T |
 |
| Q |
115 |
aactaccagattacattacttcttctgagacaatatttttgtaaatgattacaatttacatcaatctcttattgtgtctaact |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36680498 |
aactaccagattacattacttcttctgagacaatatttttgtaaatgattacaatttacatcagtctcttattgtgtctaact |
36680580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University