View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7961_high_21 (Length: 222)
Name: NF7961_high_21
Description: NF7961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7961_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 207
Target Start/End: Original strand, 24660575 - 24660766
Alignment:
| Q |
16 |
atatttgttaagcttcacttcagaatataacatctttggataactcataattgtttcttcatctaaaccaaaatcaagtattgaatgttgtggttcaaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24660575 |
atatttgttaagcttcacttcagaatataacatctttggataactcataattgtttcttcatctaaaccaaaatcaagtattgaatgttgaggttcaaga |
24660674 |
T |
 |
| Q |
116 |
aattcagatgtgttattgttgtttcttcttctaggaggatttggaacttgtgatcttgtgcaaaagtaggaggtgagtgtgattgttgtaat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24660675 |
aattcagatgtgttattgttgtttcttctcctaggaggatttggaacttgtgatcttgtgcaaaagtaggaggtgagtgtgatggttgtaat |
24660766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University