View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7961_low_15 (Length: 287)
Name: NF7961_low_15
Description: NF7961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7961_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 19 - 162
Target Start/End: Original strand, 38789974 - 38790124
Alignment:
| Q |
19 |
cgaagagcatttgtgaattgtgatgaactggatacatgcat--gtagcgacaaaactgcagtattggacatactaactgaaagcagta-----tggatag |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38789974 |
cgaagagcatttgtgaattgtgatgaactggatacatgcatatgtagcgacaaaactgtagtattggacatactaactgaaagcagtatagtatggatag |
38790073 |
T |
 |
| Q |
112 |
tgattatcaattgaggatatgtgcaatattgaataaaagattgatcatatt |
162 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38790074 |
tgatattcaattgaggatatgtgcaatattgaataaaagattgatcatatt |
38790124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 212 - 262
Target Start/End: Original strand, 38790382 - 38790432
Alignment:
| Q |
212 |
ttatttttatcttttggaaaagaggattgaattggataagaattatctacc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38790382 |
ttatttttatcttttggaaaagaggattgaattggataagaattatatacc |
38790432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 177 - 210
Target Start/End: Original strand, 38790155 - 38790188
Alignment:
| Q |
177 |
attatttacccaaaaatgaaagtttttgtatagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38790155 |
attatttacccaaaaatgaaagtttttgtatagt |
38790188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University