View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7961_low_16 (Length: 286)
Name: NF7961_low_16
Description: NF7961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7961_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 271
Target Start/End: Original strand, 47327200 - 47327452
Alignment:
| Q |
19 |
gtcgttgcgattacaaataagaatttcaagcaatgatcctttcaaggtgctcacaacataatcatccaaaaatcgtgacaacaacgttgaggataacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47327200 |
gtcgttgcgattacaaataagaatttcaagcaatgatcctctcagggtgctcacaacatagtcatccaaaaatcgtgacaacaacgttgaggacaacaag |
47327299 |
T |
|
| Q |
119 |
tatttatctttattgtcttctaatttccgatttctcttcaacaatttcatcacacacaatgtgatgaaaggcctctttctttgttttctattaatgtttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47327300 |
tatttatctttattgtcttctaatttccgatttctcttcaacaatttcatcacacacaatatgatgaaaggcctctttctttgttttctattaatgtttc |
47327399 |
T |
|
| Q |
219 |
tcttttctttaaacacaattcagnnnnnnnaaaaagatttgattctccgttat |
271 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47327400 |
tcttttctttaaacacaattcagtttttttaaaaagatttgattctccgttat |
47327452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University