View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7961_low_22 (Length: 241)
Name: NF7961_low_22
Description: NF7961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7961_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 11356008 - 11356230
Alignment:
| Q |
1 |
tttttcaaggactcttgttgataattgaaatgagttaagtttggttgtgtnnnnnnnnnnnnnntactaatggtaataccattttctttatgtgacagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11356008 |
tttttcaaggactcttgttgataattgaaaggagttaagtaaggttgtgtaaaaaaaaaaaaa-tactaatggtgataccattttctttatgtgacagag |
11356106 |
T |
 |
| Q |
101 |
ttctcaaatatgacatgcaaaatttagagattccaaccataaatattctgggaacacttgttaagtcaggtgtaagagttcttgtatacaggttagtaag |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11356107 |
ttctcaaatataacatgcaaaatttagagattccaaccataaatattctgggaacacttgttaagtcaggtgtaagagttcttgtatacaggttagtaag |
11356206 |
T |
 |
| Q |
201 |
tgttacttcttgacattacaatct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11356207 |
tgttacttcttgacattacaatct |
11356230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 2 - 44
Target Start/End: Original strand, 11355298 - 11355340
Alignment:
| Q |
2 |
ttttcaaggactcttgttgataattgaaatgagttaagtttgg |
44 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11355298 |
ttttcaaggacttttgttgataattgaaatgagttaagtttgg |
11355340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University