View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7961_low_24 (Length: 237)
Name: NF7961_low_24
Description: NF7961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7961_low_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 45634828 - 45635069
Alignment:
| Q |
1 |
tgcaacttcatccacagtgtgtatagccccatagagaaacactgtcatattaataatattaatgtaagaaattatga-aattttatatctttgttctcat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
45634828 |
tgcaacttcatccacagtgtgtatagccccatagagaaacactgtcatattaataatattaatgtaagaaatt--gataattttatatctttgttctcat |
45634925 |
T |
 |
| Q |
100 |
ctcattatggaga--aaaagcaagcattgagttgtgtttgaaatgaaata----gaaaggattctagttcccacttaccaaggctatcaccgactacaaa |
193 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45634926 |
ctcattatggagagaaaaagcaagcattgagttgtgtttgaaatgaaatatatagaaaggattctagttcccacttaccaaggctatcaccgactacaaa |
45635025 |
T |
 |
| Q |
194 |
ggttttgtcactcgtccatgtgctatattcaacaccgatttgcc |
237 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45635026 |
ggttttttcactcgtccatttgctatattcaacaccgatttgcc |
45635069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University