View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7961_low_25 (Length: 237)

Name: NF7961_low_25
Description: NF7961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7961_low_25
NF7961_low_25
[»] chr4 (2 HSPs)
chr4 (1-221)||(19964879-19965099)
chr4 (96-188)||(4231231-4231323)
[»] chr2 (1 HSPs)
chr2 (5-196)||(33860592-33860784)
[»] chr1 (4 HSPs)
chr1 (66-196)||(45984088-45984218)
chr1 (96-188)||(7891374-7891466)
chr1 (96-184)||(50912149-50912237)
chr1 (66-193)||(38138252-38138379)
[»] chr8 (3 HSPs)
chr8 (96-188)||(1846255-1846347)
chr8 (96-196)||(4619447-4619547)
chr8 (94-196)||(4787830-4787932)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 19964879 - 19965099
Alignment:
1 cgacggtcccacccttatcgaagcttttgaccatttgaaactgcctgtgtctatgagggaaattcacaagcctctcaggataccaattcatggtttctac 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
19964879 cgacggtcccacccttatcgaagctcttgaccatttgaaactgcctgtgtctatgagggaaattcacaagcctctcaggatacgaattcatggtttctac 19964978  T
101 aaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtggtgaatttttccccaactgagctgcaacgca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |||||||||||    
19964979 aaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtgatgaattttgccccaactgggctgcaacgca 19965078  T
201 aggtgaagtctgtgaagattg 221  Q
    | |||||||||||||||||||    
19965079 aagtgaagtctgtgaagattg 19965099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 188
Target Start/End: Complemental strand, 4231323 - 4231231
Alignment:
96 tctacaaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtggtgaatttttccccaactg 188  Q
    |||||||| |||||||||| |||| ||| |||||||||||| ||| |||||||  | ||| |||||| |||||||||| |||| | |||||||    
4231323 tctacaagattggaggaattggaactgttcctgtgggacgtgttgagactggtaccatgaaacctggaatggtggtgacttttgctccaactg 4231231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 5 - 196
Target Start/End: Complemental strand, 33860784 - 33860592
Alignment:
5 ggtcccacccttatcgaagcttttgaccatttgaaactgcctgtgtctatgagggaaattcacaagcctctcaggataccaattcatggtttctacaagg 104  Q
    |||||||||||| | |||||| |||||| | |  || ||||| |||||  ||||  | ||| ||| |||||| | |||||| |||||||| ||||||| |    
33860784 ggtcccacccttcttgaagctcttgaccgtatctaattgcctctgtctgcgaggctatttctcaatcctctccgaataccacttcatggtgtctacaaag 33860685  T
105 -ttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtggtgaatttttccccaactgagctgcaa 196  Q
     ||||||||||||||||||||| ||| |||||| ||||||||||| |||||| |||||| |||| ||||| |||| ||||||||| |||||||    
33860684 attggaggaatcggaaatgtgcatgtaggacgtgttgtgactggtcacttgaaacctggaatggcggtgacttttgccccaactgggctgcaa 33860592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 66 - 196
Target Start/End: Original strand, 45984088 - 45984218
Alignment:
66 acaagcctctcaggataccaattcatggtttctacaaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggat 165  Q
    ||||||||||||| |||||| |||| | | |||||||| ||||||||||||||| |||||||||||||||| ||| |||||||| |||||  ||||| ||    
45984088 acaagcctctcagaataccacttcaggatgtctacaagattggaggaatcggaactgtgcctgtgggacgtgttgagactggttccttgaaccctggaat 45984187  T
166 ggtggtgaatttttccccaactgagctgcaa 196  Q
    |||| ||| |||| || |||||| |||||||    
45984188 ggtgctgacttttgccgcaactgggctgcaa 45984218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 188
Target Start/End: Original strand, 7891374 - 7891466
Alignment:
96 tctacaaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtggtgaatttttccccaactg 188  Q
    |||||||| |||||||||| |||| |||||||||||||||  ||| | |||||  ||||| |||||| |||||| ||| |||| |||||||||    
7891374 tctacaagattggaggaattggaattgtgcctgtgggacgcgttgagtctggtatcttgaaacctggaatggtgctgacttttgccccaactg 7891466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 184
Target Start/End: Complemental strand, 50912237 - 50912149
Alignment:
96 tctacaaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtggtgaatttttcccca 184  Q
    |||||||| |||||| ||| |||| ||| |||||||||||||||| ||| |||  ||||| || ||| |||||||||| |||| |||||    
50912237 tctacaagattggagaaattggaattgtacctgtgggacgtattgagaccggtgtcttgaaacgtggaatggtggtgacttttgcccca 50912149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 193
Target Start/End: Original strand, 38138252 - 38138379
Alignment:
66 acaagcctctcaggataccaattcatggtttctacaaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggat 165  Q
    ||||||||||| |  ||||| |||| | | |||||||| |||||||||| |||| |||||||||||||||  ||| ||  |||  ||||| ||| || ||    
38138252 acaagcctctccgattaccacttcaggatgtctacaagattggaggaattggaactgtgcctgtgggacgggttgagagcggtgtcttgaaaccaggaat 38138351  T
166 ggtggtgaatttttccccaactgagctg 193  Q
    || ||||| |||| ||||||||| ||||    
38138352 ggcggtgacttttgccccaactgggctg 38138379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 188
Target Start/End: Complemental strand, 1846347 - 1846255
Alignment:
96 tctacaaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtggtgaatttttccccaactg 188  Q
    |||||||| |||||||||| |||| |||||||||||||||  ||| | |||||  ||||| |||||| |||||| ||| |||| |||||||||    
1846347 tctacaagattggaggaattggaattgtgcctgtgggacgcgttgagtctggtatcttgaaacctggaatggtgctgacttttgccccaactg 1846255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 196
Target Start/End: Complemental strand, 4619547 - 4619447
Alignment:
96 tctacaaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtggtgaatttttccccaactgagctgca 195  Q
    |||||||| |||||||||| |||| ||||||||||||| || ||| ||| |||  ||||| |||||| ||| |||||| |||| |||| | || ||||||    
4619547 tctacaagattggaggaattggaactgtgcctgtgggatgtgttgagaccggtgtcttgaaacctggaatgatggtgacttttgccccgattgggctgca 4619448  T
196 a 196  Q
    |    
4619447 a 4619447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 196
Target Start/End: Original strand, 4787830 - 4787932
Alignment:
94 tttctacaaggttggaggaatcggaaatgtgcctgtgggacgtattgtgactggttacttgacacctgggatggtggtgaatttttccccaactgagctg 193  Q
    |||||||||| ||||||||||||||  |||| ||||||||||| | | |||||||| ||||   ||||| |||   |||| |||| ||||||||| ||||    
4787830 tttctacaagattggaggaatcggagttgtgtctgtgggacgtgtcgagactggttgcttgtgccctggaatgtctgtgacttttgccccaactgggctg 4787929  T
194 caa 196  Q
    |||    
4787930 caa 4787932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University