View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7961_low_26 (Length: 232)

Name: NF7961_low_26
Description: NF7961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7961_low_26
NF7961_low_26
[»] chr2 (1 HSPs)
chr2 (1-215)||(41414111-41414325)


Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 41414325 - 41414111
Alignment:
1 acatatagtgagagatcaattcagaatgggccctctccctaacaggtggagtgcacaaaagccatcctcgtttattaaccgtgaacttttaattatttaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41414325 acatatagtgagagatcaattcagaatgggccctctccctaacaggtggagtgcacaaaagccatcctcgtttattaaccgtgaacttttaattatttaa 41414226  T
101 aaatgtactatgcatgtagtatgatagattgcttttctcaactttcaatcacaaccataagtggtcacacttttgtgtgagaaccccttgctatatagta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41414225 aaatgtactatgcatgtagtatgatagattgcttttctcaactttcaatcacaaccataagtggtcacacttttgtgtgagaaccccttgctatatagta 41414126  T
201 gtatatagtatacac 215  Q
    |||||| ||||||||    
41414125 gtatatggtatacac 41414111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University