View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7962_low_21 (Length: 365)
Name: NF7962_low_21
Description: NF7962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7962_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 10200412 - 10200224
Alignment:
| Q |
1 |
acattccaatacaacaaatcatttaatcataaaatgatggaaaactaatcatgatcaaagctttagaatttatttattatcttcttctattcacccatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10200412 |
acattccaatacaacaaatcatttaatcataaaatgatggaaaactaatcatgatcaaagctttagaatttatttattatcttcttctattcacccgtat |
10200313 |
T |
|
| Q |
101 |
aacttttaatttttgcgaaaatttcattaagtcctctcgactcttataacttcataaaatactttgaaattttaagtttgtattatata |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10200312 |
aacttttaatttttgcgaaaatttcattaagtcctctcaactcttataacttcataaaatactttgaaattttaagtttgtattatata |
10200224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 303 - 351
Target Start/End: Complemental strand, 10200098 - 10200050
Alignment:
| Q |
303 |
acagtctcctaaaatcttaattcaatacaatccataacttcatgatatt |
351 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
10200098 |
acagtctcctaaaatcttaattcaatgcaccccataacttcatgatatt |
10200050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University