View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7962_low_28 (Length: 326)
Name: NF7962_low_28
Description: NF7962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7962_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 15 - 170
Target Start/End: Complemental strand, 27771241 - 27771086
Alignment:
| Q |
15 |
atgttagttcatcaaagatatcacaaggagaaagtagtaaatcaaggtacaaaagaagagtgttgcattgtgttatgagtccaattgcaatgaagagatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27771241 |
atgttagttcatcaaagatatcacaaggagaaagtagtaaatcaaggtacaaaagaagagtgttgcattgtgttatgagtccaattgcaatgaagagatc |
27771142 |
T |
|
| Q |
115 |
gttttctaatggaagattttcactaggtaaaattgatagaggaaaaaggcaaggaa |
170 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27771141 |
gttttctaatggaagattttcacttggtaaaattgatagaggaaaaaggcaaggaa |
27771086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 219 - 271
Target Start/End: Complemental strand, 27771038 - 27770986
Alignment:
| Q |
219 |
atgatatattaagaagagagatagaccaattttttgtgtgaagattgcataaa |
271 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27771038 |
atgatatattaagaagagagacagaccaattttttgtgtgaagattgcataaa |
27770986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 77 - 134
Target Start/End: Complemental strand, 12617343 - 12617286
Alignment:
| Q |
77 |
ttgcattgtgttatgagtccaattgcaatgaagagatcgttttctaatggaagatttt |
134 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
12617343 |
ttgcattgtgtgctaagtccaattgcaatgaagagatcattttcaagtggaagatttt |
12617286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University