View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7962_low_32 (Length: 314)
Name: NF7962_low_32
Description: NF7962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7962_low_32 |
 |  |
|
| [»] scaffold0743 (1 HSPs) |
 |  |  |
|
| [»] scaffold1104 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0743 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 43 - 304
Target Start/End: Complemental strand, 6377 - 6116
Alignment:
| Q |
43 |
aggttgagggaaagagagagggtgcaatagagacatagagatggaaaagatggtggttatgagtgatgagaaacaagattttatcaacaagcttccaaat |
142 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6377 |
aggttgagggattgagagagggtgcaatagagacatggagatggaaaagatggtggttatgagtgatgagaaacaagagtttatcaacaagcttccaaat |
6278 |
T |
 |
| Q |
143 |
gatgtcttaaccttcatcctttccaaacttcatgttgacgaagctgtgagatgcaacatcctctcaaaaagatggctaggtctttggaagcaagctcatc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6277 |
gatgtcttaaccttcatcctttccaaacttcatgttgacgaagctgtgagatgcaacatcctctcaaaaagatggctaggtctatggaagcaagctcatc |
6178 |
T |
 |
| Q |
243 |
acattgaattcaatgcaaaacatatgatcaaacccttgactcagctcttacacacaggttct |
304 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
6177 |
acattgaattcaatgcaaaacacatgatcaaacccatgactcagctcttacacaaaggttct |
6116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1104 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: scaffold1104
Description:
Target: scaffold1104; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 233 - 303
Target Start/End: Original strand, 247 - 317
Alignment:
| Q |
233 |
caagctcatcacattgaattcaatgcaaaacatatgatcaaacccttgactcagctcttacacacaggttc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||| |||||| |
|
|
| T |
247 |
caagctcatcacattgaattcaatgcaaaacatatgatcaaaacaatgactcaactcttacacaaaggttc |
317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1104; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 27 - 90
Target Start/End: Original strand, 182 - 246
Alignment:
| Q |
27 |
caatagctcttgggagagg--ttgagggaaagagagagggtgcaatagagacatagagatggaaaa |
90 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
182 |
caatagctcttgggagacaatttgagggaaagagagagg-tgcaatagagataaagagatggaaaa |
246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 25 - 73
Target Start/End: Complemental strand, 30374944 - 30374894
Alignment:
| Q |
25 |
tacaatagctcttgggagag--gttgagggaaagagagagggtgcaataga |
73 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30374944 |
tacaatagctcttgggagagaggttgagggaaagagagagggtgcaataga |
30374894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 25 - 73
Target Start/End: Complemental strand, 30376797 - 30376747
Alignment:
| Q |
25 |
tacaatagctcttgggagag--gttgagggaaagagagagggtgcaataga |
73 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30376797 |
tacaatagctcttgggagagaggttgagggaaagagagagggtgcaataga |
30376747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University