View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7963_high_10 (Length: 377)
Name: NF7963_high_10
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7963_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 354; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 39231179 - 39231536
Alignment:
| Q |
1 |
gcttatagcttcagctaaagaacatgtagcaaatgagtgcaagccagtgcagaatcttttattctcggattgcaaacttggaattaatgatcttccaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231179 |
gcttatagcttcagctaaagaacatgtagcaaatgagtgcaagccagtgcagaatcttttattctcggattgcaaacttggaattaatgatcttccaaac |
39231278 |
T |
 |
| Q |
101 |
catgtgtatgaagttgattgggatgtaatattggttgacgggcctcgtggggattggccggaagctcccgggagaatgtcggcgatatttacagccgggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39231279 |
catgtgtatgaagttgattgggatgtaatattggttgacgggcctcgtggggattggccggaagctcccgggagaatgtcggcgatatttaccgccgggg |
39231378 |
T |
 |
| Q |
201 |
tgttggctagaagtaagaaaggtggtaacccaaagactcatgtgtttttgcatgatttttctggtgaagttgaacaagtttgtgggaatgagtttttgtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231379 |
tgttggctagaagtaagaaaggtggtaacccaaagactcatgtgtttttgcatgatttttctggtgaagttgaacaagtttgtgggaatgagtttttgtg |
39231478 |
T |
 |
| Q |
301 |
taaagagaatttgttggaagcaagtgagagtatggggcattatgttttggaaaggatg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39231479 |
taaagagaatttgttggaagcaagtgagagtatggggcattatgttttggaaaggatg |
39231536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 220
Target Start/End: Complemental strand, 33371872 - 33371810
Alignment:
| Q |
158 |
ccggaagctcccgggagaatgtcggcgatatttacagccggggtgttggctagaagtaagaaa |
220 |
Q |
| |
|
|||| |||||| ||||||||||||||||| |||||||| | ||||||||||| || |||||| |
|
|
| T |
33371872 |
ccggcagctccggggagaatgtcggcgatctttacagcagcagtgttggctaggagcaagaaa |
33371810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University