View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7963_high_12 (Length: 338)
Name: NF7963_high_12
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7963_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 6 - 324
Target Start/End: Complemental strand, 7057476 - 7057158
Alignment:
| Q |
6 |
cagagactcgtccttggatacactctgggccgcaggaggtggcaaagaaaaattattagctaatgaaatttctggtggaacagtttttggtataatctcc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7057476 |
cagagactcgtccttggatacactctgggccgcaggaggtggcaaagaaaaattattagctaatgaaatttctggtggaacagtttttggtataatctcc |
7057377 |
T |
 |
| Q |
106 |
gatggcctgatatcgacattagagtgtgagtttctctttggtgaggctccaacattgatataagaattggtactcttcaagctgctaattattgtatgtt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7057376 |
gatggcctgatatcgacattagagtgtgagtttctctttggtgaggctccaacattgatataagaattggtactcttcaagctgccaattattgtatgtt |
7057277 |
T |
 |
| Q |
206 |
gcggttcaggcataatcttagcaaaggggaagctcaatggtgatgaatgaggactagccatatcataatctttcacaccatcctgaacatcttgcatttt |
305 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7057276 |
gcggttcaggcataatcttagcaaaagggaagctcaatggtgatgaatgaggactagccatatcataatctttcacaccatcctgaacatcttgcatttt |
7057177 |
T |
 |
| Q |
306 |
cttaaatgcctttgctgat |
324 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7057176 |
cttaaatgcctttgctgat |
7057158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University