View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7963_low_13 (Length: 341)
Name: NF7963_low_13
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7963_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 4 - 122
Target Start/End: Original strand, 12635768 - 12635887
Alignment:
| Q |
4 |
agtgtagcgtagccacaaactttaattt-gttttttgcattagggattttatatggaactatttcaaatctgaatgacttagactttggtttgattatca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12635768 |
agtgtagcgtagccacaaactttaattttgttttttgcattagggattttatatggaactatttcaaatctgaatgacttagactttggtttgattatca |
12635867 |
T |
 |
| Q |
103 |
agcactattctaacttcaga |
122 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12635868 |
agcactattctaacttcaga |
12635887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 229 - 308
Target Start/End: Original strand, 12635892 - 12635972
Alignment:
| Q |
229 |
attttgattttcactcagaccacacattctaaacaatgcttacattttgtttcgatagtgagacac-ttttttacattgaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
12635892 |
attttgattttcactcagaccacacattctaaacaatgcttacattttgtttagatagtgagacactttttttacattgaa |
12635972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University