View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7963_low_25 (Length: 272)
Name: NF7963_low_25
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7963_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 230040 - 230139
Alignment:
| Q |
1 |
gaatggtggaggtgaggcagggggtggtgatgcaggtggtggagtagactgaacaggtggaggagtgagtggggttggaggaggagattgctgaacaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
230040 |
gaatggtggaggtgaggcagggggtggtgatgcaggtggtggagtagactgaacaggtggaggagtgagtggggttggaggaggagattgctgaacaggt |
230139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 181 - 254
Target Start/End: Original strand, 230220 - 230293
Alignment:
| Q |
181 |
gggtggaggagaagattgaacaggtggaggggaggcttgaggagtggttgggggtgtattagaaggaggagtgg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
230220 |
gggtggaggagaagattgaacaggtggaggggaggcttgaggagtggttgggggtgtattagcaggaggagtgg |
230293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University