View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7963_low_26 (Length: 271)
Name: NF7963_low_26
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7963_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 165 - 255
Target Start/End: Original strand, 6858370 - 6858460
Alignment:
| Q |
165 |
cctccacttcgaaattccatatcaaacccactcactgaactcgaccgttgaagtctcactgtccatttcacacttcaaaacctaagcttat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6858370 |
cctccacttcgaaattccatatcaaacccactcactgaacttgaccgttgaagtctcactgtccatttcacacttcaaaacctaagcttat |
6858460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University