View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7963_low_26 (Length: 271)

Name: NF7963_low_26
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7963_low_26
NF7963_low_26
[»] chr5 (1 HSPs)
chr5 (165-255)||(6858370-6858460)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 9e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 165 - 255
Target Start/End: Original strand, 6858370 - 6858460
Alignment:
165 cctccacttcgaaattccatatcaaacccactcactgaactcgaccgttgaagtctcactgtccatttcacacttcaaaacctaagcttat 255  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
6858370 cctccacttcgaaattccatatcaaacccactcactgaacttgaccgttgaagtctcactgtccatttcacacttcaaaacctaagcttat 6858460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University