View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7963_low_28 (Length: 260)
Name: NF7963_low_28
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7963_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 31309197 - 31308943
Alignment:
| Q |
1 |
cgcgtgcatcgcttccattagttgctcaacggcgccggttacgagtgggccgatcccgtcgcctgggattagggttacgggacggggggttccatcgccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
31309197 |
cgcgtgcatcgcttccattagttgctcaacggcgccggttacgagtgggccgatcccgtcgccggggattagggttacgggacggggagttccgtcgccg |
31309098 |
T |
 |
| Q |
101 |
ggacggtgcatgtaggttacacatcgctttgagatagtgaatggttcggattgggatcgggttgagaggaggtgtttgaggaggggtatggatcttcttg |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31309097 |
ggacggtgcatgtaggttacgcatcgctttgagatagtgaatggttcggattgggatcgggttgagaggaggtgtttgaggaggggtatggatcttcttg |
31308998 |
T |
 |
| Q |
201 |
ttgccattggtgatgaaggttggagggtttttgagaaaaaaggggggtgtgagat |
255 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31308997 |
ttgccattggtgatgaaggttggggggtttttgagaaaaaaggggggtgtgagat |
31308943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 5 - 120
Target Start/End: Original strand, 9434594 - 9434709
Alignment:
| Q |
5 |
tgcatcgcttccattagttgctcaacggcgccggttacgagtgggccgatcccgtcgcctgggattagggttacgggacggggggttccatcgccgggac |
104 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||| ||||| ||||||||||| ||||| |||||||||||||||| ||||||||||| || ||||| | |
|
|
| T |
9434594 |
tgcatcgcttccattacttgctcaacagcgccggtaacgagagggccgatcccatcgccggggattagggttacggtgcggggggttccgtctccggggc |
9434693 |
T |
 |
| Q |
105 |
ggtgcatgtaggttac |
120 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
9434694 |
ggggcatgtaggttac |
9434709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University