View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7963_low_33 (Length: 245)
Name: NF7963_low_33
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7963_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 43747601 - 43747817
Alignment:
| Q |
11 |
gatgaactaggtccaacataaaaatttaataaggtattaaggcgcggggtattgtaatgtagccggataatttgctctgaccctatcacttctcgtcaac |
110 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
43747601 |
gatgaactaggtcgaacataaaaatttaataaggtattaaggcgcggggtattgtaatgtagccggataatttgctcggaccccatcacttctcgtcaac |
43747700 |
T |
 |
| Q |
111 |
caccaaatgtttaaagtcaaagtttactatatatatggaaaatgcaacactcatccactgttctttccattttatatgtatttgtgtgcgtgtgtatgtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43747701 |
caccaaatgtttaaagtcaaagtttactatatatatggaaaatgcaacactcatccactgttctttccattttatatgtatttgtgtgcgtgtgtgtgtt |
43747800 |
T |
 |
| Q |
211 |
cagttagagggaccact |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43747801 |
cagttagagggaccact |
43747817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University