View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7963_low_41 (Length: 205)
Name: NF7963_low_41
Description: NF7963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7963_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 10995136 - 10994964
Alignment:
| Q |
17 |
cactgatttccatctttatcgaaacggtaaagcttcgatttgagatctagaatggattcttcgtcttcttcaccggtagtgacggcaacttcttggagtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10995136 |
cactgatttccatctttatcgaaacggtaaagcttcgatttgagatctagaatggattcttcgtcttcttcaccggtagtgacggcaacttcttggagtt |
10995037 |
T |
|
| Q |
117 |
ggacgatcggagcgacttgtgctcgggtgtcttcgtcgtcaccaacggcgggtgcttcctcctcttcgcggtg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10995036 |
ggacgatcggagcgacttgtgctcgggtgtcttcgtcgtcaccgacggcgggtgcttcctcctcttcgcggtg |
10994964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 119; Significance: 5e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 59 - 189
Target Start/End: Complemental strand, 44025103 - 44024973
Alignment:
| Q |
59 |
agatctagaatggattcttcgtcttcttcaccggtagtgacggcaacttcttggagttggacgatcggagcgacttgtgctcgggtgtcttcgtcgtcac |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44025103 |
agatctagaatggattcttcgtcttcttcaccggtagtgacggcaacttcttggagttggacaatcggagcgacttgtgctccggtgtcttcgtcgtcac |
44025004 |
T |
|
| Q |
159 |
caacggcgggtgcttcctcctcttcgcggtg |
189 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
44025003 |
cgacggcgggtgcttcctcctcttcgcggtg |
44024973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 44025225 - 44025184
Alignment:
| Q |
17 |
cactgatttccatctttatcgaaacggtaaagcttcgatttg |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44025225 |
cactgatttccatctttatcgaaacggtaaagctttgatttg |
44025184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University