View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7964_low_10 (Length: 234)
Name: NF7964_low_10
Description: NF7964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7964_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 42967761 - 42967977
Alignment:
| Q |
1 |
agaacttgcatgacaagtcatacatacacatatattggcatgtcatacgcagtttttgtgaacgaaacaaactcaacctattgtcaccacaagactttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42967761 |
agaacttgcatgacaagtcatacatacacatatattggcatgtcatacgcagtttttgtgaacgaaacaaactcaacctattgtcaccacaagactttat |
42967860 |
T |
|
| Q |
101 |
tcaaatttattgtgatttttgataagctacaaattgattgtgaattctttactgcaccaatcgaaatgaattataaatagttcaaattcaattcatttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
42967861 |
tcaaatttattgtgatttttgataagctacaaattgattgtgaattctttactgcaccaaacgaaatgaattacacatagttcaaattcaattcatttat |
42967960 |
T |
|
| Q |
201 |
cttaccaactcaatttt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42967961 |
cttaccaactcaatttt |
42967977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University