View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7965_high_13 (Length: 364)
Name: NF7965_high_13
Description: NF7965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7965_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 351
Target Start/End: Complemental strand, 7797603 - 7797252
Alignment:
| Q |
1 |
ttgggatccattgctggttctgctatgatgaggaaggcagcttcccttgctttctcaaataagagaagatcaactgtcaccggtgacatcattgaatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7797603 |
ttgggatccattgctggttctgctatgatgaggaaggcagcttcccttgctttctcaaataagaaaagatcaactgtcaccggtgacatcattgaatgct |
7797504 |
T |
 |
| Q |
101 |
tggggaaaaggtagcttattattgaaaatttgaaaaacattt-gtttgattatgagcaagatgcgttacgaataagctcgtctattctttcttgcagttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7797503 |
tggggaaaaggtagcttattattgaaaatttgaaaaacattttgtttgattatgagcaagctgcgttaggaataagctcgtctattctttcttgcagttt |
7797404 |
T |
 |
| Q |
200 |
ggaagatatttgtcctgccggttcatgcagtctgtgacctccaaacacttgtataaaacgtgtcgagttactgctatgatttgcctaaaaaatagtttgt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7797403 |
ggaagatatttgtcctgccggttcatgcagtttgtgacctccaaacacttgtgtaaaacatgtcgagttactgctatgatttgcctaaaaaatagtttgt |
7797304 |
T |
 |
| Q |
300 |
tatatttaataaaggcagtcacgctgtttgtgacatccatcaactcaagtct |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7797303 |
tatatttaataaaggcagtcacgctgtttgtgacatccatcaactcaagtct |
7797252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University