View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7965_high_16 (Length: 316)
Name: NF7965_high_16
Description: NF7965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7965_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 182 - 299
Target Start/End: Original strand, 34871112 - 34871229
Alignment:
| Q |
182 |
caagcaatatttgaacactagtcgtcatctatgagtgtttgtgcgggttttatgttgtattttactgagtaaggatgttcatgtgttgagttggttcggt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
34871112 |
caagcaatatttgaacactagtcgtcatctatgagtgtttgtgcgggttttatgttgtattttaatgagtaaggatgttaatgtgttgagttggttcggt |
34871211 |
T |
|
| Q |
282 |
ttagatcaaattaattac |
299 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
34871212 |
ttagatcaaactaattac |
34871229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 34870935 - 34871045
Alignment:
| Q |
1 |
cgcaaagattaccttatttatgaacaagacgaatgagatgctttggttactgaaatgggaagctttctattagtatatattcttcgaccatttggttttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
34870935 |
cgcaaagattaccttatttatgaacaagacgaatgagatgctttggttactgaaatgggaagctttctattag----tattcttcgaccatttgcttttt |
34871030 |
T |
|
| Q |
101 |
tgtaagagtcagaaa |
115 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
34871031 |
tataagagtcagaaa |
34871045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University