View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7965_high_18 (Length: 287)
Name: NF7965_high_18
Description: NF7965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7965_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 29513153 - 29513216
Alignment:
| Q |
16 |
atgaaaattccttttcagtccgtttaactaaccacaccttcaatttagaaattagtcgcacaat |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29513153 |
atgaaaattccttttcagtccgtttaactaaccagaccttcaatttagaaattagtcgcacaat |
29513216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 37 - 130
Target Start/End: Original strand, 29513093 - 29513186
Alignment:
| Q |
37 |
gtttaactaaccacaccttcaatttagaaattagtcgcacaattaccacatgttagaaaaatgataattcatgttgtgtccgtttaactaacca |
130 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| ||||| |||||||||||||||| ||||| | || ||||||||||||||||| |
|
|
| T |
29513093 |
gtttaactaaccacaccttcaatttacaaattcgtcgcacatttaccgcatgttagaaaaatgaaaattccttttcagtccgtttaactaacca |
29513186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University