View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7965_high_27 (Length: 219)
Name: NF7965_high_27
Description: NF7965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7965_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 40546663 - 40546863
Alignment:
| Q |
1 |
tgttatattgatgtgcttaattgagcaatactaaaatctagtatgtagtgaaaatttctatttgggtgtgggtgcagacatattcacaccagatctacta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40546663 |
tgttatattgatgtgcttaattgagcaatactaaaatctagtatgtagtgaaaatttctatttgggtgtgggtgcagacatattcacaccaaatctacta |
40546762 |
T |
 |
| Q |
101 |
ttcaggctttcaaatttctactagtatttgtgatcttgtgttgcaggctgataatatatttctttatccttgatagaggttttgttggattagggagaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40546763 |
ttcaggctttcaaatttctactagtatttgtgatcttatgttgcaggctgataatatatttctttatccttgatagaggttttgttggattagggataga |
40546862 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
40546863 |
t |
40546863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University