View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7965_low_31 (Length: 219)

Name: NF7965_low_31
Description: NF7965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7965_low_31
NF7965_low_31
[»] chr5 (1 HSPs)
chr5 (1-201)||(40546663-40546863)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 40546663 - 40546863
Alignment:
1 tgttatattgatgtgcttaattgagcaatactaaaatctagtatgtagtgaaaatttctatttgggtgtgggtgcagacatattcacaccagatctacta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
40546663 tgttatattgatgtgcttaattgagcaatactaaaatctagtatgtagtgaaaatttctatttgggtgtgggtgcagacatattcacaccaaatctacta 40546762  T
101 ttcaggctttcaaatttctactagtatttgtgatcttgtgttgcaggctgataatatatttctttatccttgatagaggttttgttggattagggagaga 200  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
40546763 ttcaggctttcaaatttctactagtatttgtgatcttatgttgcaggctgataatatatttctttatccttgatagaggttttgttggattagggataga 40546862  T
201 t 201  Q
    |    
40546863 t 40546863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University