View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_high_35 (Length: 286)
Name: NF7966_high_35
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 39578742 - 39578474
Alignment:
| Q |
1 |
acaacaatcaacacgcaagtgtctccatgaactgttttgtagatagctcacttctctgttttgtccctgtttcgccccttagttaatggttgttggtctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39578742 |
acaacaatcaacacgcaagtgtctccatgaactgttttgtagatagctcacttctctgttttgtccctgtttccccccttagttaatggttgttggtctg |
39578643 |
T |
 |
| Q |
101 |
ttctcaattgtaagattaataatggagtaaaacagtattcattttcaagtgattatatgaagatctatgtatggtagaatgttgtgattttcttccatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578642 |
ttctcaattgtaagattaataatggagtaaaacagtattcattttcaagtgattatatgaagatctatgtatggtagaatgttgtgattttcttccatgc |
39578543 |
T |
 |
| Q |
201 |
taaatacaatttcaaatatgtcaaactgtaatttgagtaatcgtacttgtagtgtagtataattgttga |
269 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578542 |
taaatacaatttcaaatatgtcaaactgcaatttgagtaatcgtacttgtagtgtagtataattgttga |
39578474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 39542374 - 39542302
Alignment:
| Q |
1 |
acaacaatcaacacgcaagtgtctccatgaactgttttgtagatagctcacttctctgttttgtccctgtttc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| | ||| |||| ||||||||||||||| |||||| |
|
|
| T |
39542374 |
acaacaatcaacacgcaagtgtctccatgagctgttttttcaatacctcatttctctgttttgtccttgtttc |
39542302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University