View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_high_37 (Length: 275)
Name: NF7966_high_37
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 11 - 257
Target Start/End: Complemental strand, 17357327 - 17357081
Alignment:
| Q |
11 |
tgttgatgagaagggggtgtagatagaacattttggatagctctcattattacatcattctcaatttgtgttgtagagtataattgtgttggtgtgattt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17357327 |
tgttgatgagaagggggtgtagatagaacattttggattgctctcattattacatcattctcaatttgtgttgtagggtataattgtgttggtgtgattt |
17357228 |
T |
 |
| Q |
111 |
gaggcaattgttgaagttgaagaggtagtagtgtgtttgaaacaggtctcattggtggaatatttactcctccaagttgggtaagatcaggtgaaaattg |
210 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17357227 |
gaggtaattgttgaagttgaagaggtagtagtgtgtttgaaacaggtctcattggtggaatatttactcctccaagttgggtaagatcaggtgaaaattg |
17357128 |
T |
 |
| Q |
211 |
aggtggagaagttccaggtggaatgttgaatatgagagatgagtatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17357127 |
aggtggagaagttccaggtggaatgttgaatatgagagatgagtatt |
17357081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University