View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_high_39 (Length: 266)
Name: NF7966_high_39
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 39689920 - 39690155
Alignment:
| Q |
18 |
gtaataccttgaaactgtttggtgaaatgccgcaaccgttatcgatgacttgaaaccattcttcaccgaagtctttaagagagatttcgatgctggtggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39689920 |
gtaataccttgaaactgtttggtgaaatgccgcaaccgttatcgatgacttgaaaccattcttcaccgaagtctttaagagagatttcgatgctggtggc |
39690019 |
T |
|
| Q |
118 |
gccggcgtctaagctattttcgacgagttctttaacggcggaggagaggtcgaggatgacttgaccggaacagattctgtgaacgattccctttgcgatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39690020 |
gccggcgtctaagctattttcgacgagttctttaacggcggaggagaggtcgaggatgacttgaccggaacagattctgtgaacgattccctttgcgatt |
39690119 |
T |
|
| Q |
218 |
ggtttgattatttgcgattcgatcgtcatctctgct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39690120 |
ggtttgattatttgcgattcgatcgtcatttctgct |
39690155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University