View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_high_40 (Length: 266)
Name: NF7966_high_40
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_high_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 33903675 - 33903841
Alignment:
| Q |
20 |
ttttgttggtgttgacattgaagatagagaaatataagaagttcttaaagcatgatttagcaatgacagtgaataataatcaatgtgccacacttgtctg |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33903675 |
ttttgttggtgttgacattgaggatagagaaatataagaacttcttaaagcatgatttagcaatgacagtaaataataatcaatgtgccacacttgtctg |
33903774 |
T |
 |
| Q |
120 |
tcatactatgatcccatagtccacgcctgtccatattaggtcacaccctcctacttattcattttgt |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903775 |
tcatgctatgatcccatagtccacgcctgtccatattaggtcacaccctcctacttattcattttgt |
33903841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 185 - 255
Target Start/End: Original strand, 33908232 - 33908301
Alignment:
| Q |
185 |
gtttttacctaaaaataaattacatgttaaccaaaatcggcaagcatttagggataggggaattcatctca |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33908232 |
gtttttacctaaaaataaattacatgttaaccaaaatcggcaagcatttagggata-gggaattcatctca |
33908301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University