View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_high_50 (Length: 239)
Name: NF7966_high_50
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_high_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 32649722 - 32649593
Alignment:
| Q |
94 |
gcgttattgcacaaaagtactactatagtacaagtaataataaatataaagacaaacaaactataaaacaatagacagtttaacatgcattccccccttt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32649722 |
gcgttattgcacaaaagtactactatagtacaagtaataataaatataaagacaaacaaactataaaacaatagacagtttaacatgcattccccccttt |
32649623 |
T |
 |
| Q |
194 |
tcctctaatcattattagcatgtcctaatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32649622 |
tcctctaatcattattagcatgtcctaatt |
32649593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University