View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7966_high_50 (Length: 239)

Name: NF7966_high_50
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7966_high_50
NF7966_high_50
[»] chr2 (1 HSPs)
chr2 (94-223)||(32649593-32649722)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 32649722 - 32649593
Alignment:
94 gcgttattgcacaaaagtactactatagtacaagtaataataaatataaagacaaacaaactataaaacaatagacagtttaacatgcattccccccttt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32649722 gcgttattgcacaaaagtactactatagtacaagtaataataaatataaagacaaacaaactataaaacaatagacagtttaacatgcattccccccttt 32649623  T
194 tcctctaatcattattagcatgtcctaatt 223  Q
    ||||||||||||||||||||||||||||||    
32649622 tcctctaatcattattagcatgtcctaatt 32649593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University