View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_high_56 (Length: 221)
Name: NF7966_high_56
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_high_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 118 - 211
Target Start/End: Complemental strand, 3323337 - 3323244
Alignment:
| Q |
118 |
gttccctagttttacattattcacaattttggtattccaacttttaaatatccaacattttctccacctatgcatcatttgaggttgatattct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3323337 |
gttccctagttttacattattcacaattttggtattccaacttttaaatatccaacattttctccacctatgcatcatttgaggttgattttct |
3323244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 55
Target Start/End: Complemental strand, 3323435 - 3323400
Alignment:
| Q |
20 |
ctagaaattatcttgtacatactaatgtgattctgg |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3323435 |
ctagaaattatcttgtacatactaatgtgattctgg |
3323400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University