View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7966_low_24 (Length: 391)
Name: NF7966_low_24
Description: NF7966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7966_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 66 - 384
Target Start/End: Original strand, 40317303 - 40317621
Alignment:
| Q |
66 |
tggcggaaggaacccccggcgccgatatccaccgtatactcgccgccgttaaatcctccgaggcaagttacttccatttctcgcttcaatttttctactc |
165 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317303 |
tggcggaaggaaactccggcgccgatatccaccgtatactcgccgccgttaaatcctccgaggcaagttacttccatttctcgcttcaatttttctactc |
40317402 |
T |
 |
| Q |
166 |
gtcaactaccttttcattctcttcacgaattttagggtttcgcgctaaaatttccacttcgtttttctttcattttcgttgcaggttgttgaagatcgtg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317403 |
gtcaactaccttttcattctcttcacgaattttagggtttcgcgctaaaatttccacttcgtttttctttcattttcgttgcaggttgttgaagatcgtg |
40317502 |
T |
 |
| Q |
266 |
ctcaattgtttactgatctaggaaatttaagcttgaaagaagcttcagaatccgatcatgcttccgtcatgaattgccttgtagtatcctttcttcatct |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40317503 |
ttcaattgtttactgatctaggaaatttaagcttgaaagaagcttcagaatccgatcatgcttccgtcatgaattgccttgtagtatcctttcttcatct |
40317602 |
T |
 |
| Q |
366 |
tcttcaatgtttgtgatgt |
384 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
40317603 |
tcttcaatgtttgttatgt |
40317621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University